From 94890fdb336d38354adec511762e2f917980bec6 Mon Sep 17 00:00:00 2001 From: sagitter Date: May 29 2020 15:54:06 +0000 Subject: Remove obsolete Python3.9 patch --- diff --git a/python-biopython-1.76_python39.patch b/python-biopython-1.76_python39.patch deleted file mode 100644 index 5f5fabe..0000000 --- a/python-biopython-1.76_python39.patch +++ /dev/null @@ -1,617 +0,0 @@ ---- a/Bio/SeqIO/UniprotIO.orig.py 2020-02-29 21:32:54.957544008 +0100 -+++ b/Bio/SeqIO/UniprotIO.py 2020-02-29 21:38:42.446966155 +0100 -@@ -252,11 +252,11 @@ def _parse_comment(element): - - if element.attrib["type"] in simple_comments: - ann_key = "comment_%s" % element.attrib["type"].replace(" ", "") -- for text_element in element.getiterator(NS + "text"): -+ for text_element in element.iter(NS + "text"): - if text_element.text: - append_to_annotations(ann_key, text_element.text) - elif element.attrib["type"] == "subcellular location": -- for subloc_element in element.getiterator(NS + "subcellularLocation"): -+ for subloc_element in element.iter(NS + "subcellularLocation"): - for el in subloc_element: - if el.text: - ann_key = "comment_%s_%s" % ( -@@ -265,21 +265,21 @@ def _parse_comment(element): - ) - append_to_annotations(ann_key, el.text) - elif element.attrib["type"] == "interaction": -- for interact_element in element.getiterator(NS + "interactant"): -+ for interact_element in element.iter(NS + "interactant"): - ann_key = "comment_%s_intactId" % element.attrib["type"] - append_to_annotations(ann_key, interact_element.attrib["intactId"]) - elif element.attrib["type"] == "alternative products": -- for alt_element in element.getiterator(NS + "isoform"): -+ for alt_element in element.iter(NS + "isoform"): - ann_key = "comment_%s_isoform" % element.attrib["type"].replace( - " ", "" - ) -- for id_element in alt_element.getiterator(NS + "id"): -+ for id_element in alt_element.iter(NS + "id"): - append_to_annotations(ann_key, id_element.text) - elif element.attrib["type"] == "mass spectrometry": - ann_key = "comment_%s" % element.attrib["type"].replace(" ", "") - start = end = 0 -- for el in element.getiterator(NS + "location"): -- pos_els = list(el.getiterator(NS + "position")) -+ for el in element.iter(NS + "location"): -+ pos_els = list(el.iter(NS + "position")) - # this try should be avoided, maybe it is safer to skip position parsing for mass spectrometry - try: - if pos_els: -@@ -287,12 +287,10 @@ def _parse_comment(element): - start = end - 1 - else: - start = int( -- list(el.getiterator(NS + "begin"))[0].attrib["position"] -+ list(el.iter(NS + "begin"))[0].attrib["position"] - ) - start -= 1 -- end = int( -- list(el.getiterator(NS + "end"))[0].attrib["position"] -- ) -+ end = int(list(el.iter(NS + "end"))[0].attrib["position"]) - except (ValueError, KeyError): - # undefined positions or erroneously mapped - pass -@@ -307,9 +305,9 @@ def _parse_comment(element): - elif element.attrib["type"] == "sequence caution": - pass # not parsed: few information, complex structure - elif element.attrib["type"] == "online information": -- for link_element in element.getiterator(NS + "link"): -+ for link_element in element.iter(NS + "link"): - ann_key = "comment_%s" % element.attrib["type"].replace(" ", "") -- for id_element in link_element.getiterator(NS + "link"): -+ for id_element in link_element.iter(NS + "link"): - append_to_annotations( - ann_key, - "%s@%s" -From 9c2879e5a91935e675de0a5774ad23e7368e0764 Mon Sep 17 00:00:00 2001 -From: Karthikeyan Singaravelan -Date: Sun, 1 Mar 2020 18:35:57 +0530 -Subject: [PATCH] Use list()/iteration instead of getchildren for Python 3.9 -compatibility. - ---- - Bio/KEGG/KGML/KGML_parser.py | 8 ++++---- - Bio/Phylo/NeXMLIO.py | 6 +++--- - 2 files changed, 7 insertions(+), 7 deletions(-) - -diff --git a/Bio/KEGG/KGML/KGML_parser.py b/Bio/KEGG/KGML/KGML_parser.py -index c0d9f12e88..662cde36bd 100644 ---- a/Bio/KEGG/KGML/KGML_parser.py -+++ b/Bio/KEGG/KGML/KGML_parser.py -@@ -115,7 +115,7 @@ def _parse_entry(element): - new_entry = Entry() - for k, v in element.attrib.items(): - new_entry.__setattr__(k, v) -- for subelement in element.getchildren(): -+ for subelement in element: - if subelement.tag == "graphics": - _parse_graphics(subelement, new_entry) - elif subelement.tag == "component": -@@ -138,7 +138,7 @@ def _parse_reaction(element): - new_reaction = Reaction() - for k, v in element.attrib.items(): - new_reaction.__setattr__(k, v) -- for subelement in element.getchildren(): -+ for subelement in element: - if subelement.tag == "substrate": - new_reaction.add_substrate(int(subelement.attrib["id"])) - elif subelement.tag == "product": -@@ -150,7 +150,7 @@ def _parse_relation(element): - new_relation.entry1 = int(element.attrib["entry1"]) - new_relation.entry2 = int(element.attrib["entry2"]) - new_relation.type = element.attrib["type"] -- for subtype in element.getchildren(): -+ for subtype in element: - name, value = subtype.attrib["name"], subtype.attrib["value"] - if name in ("compound", "hidden compound"): - new_relation.subtypes.append((name, int(value))) -@@ -163,7 +163,7 @@ def _parse_relation(element): - self.pathway = Pathway() - # Get information about the pathway itself - _parse_pathway(self.entry.attrib) -- for element in self.entry.getchildren(): -+ for element in self.entry: - if element.tag == "entry": - _parse_entry(element) - elif element.tag == "reaction": -diff --git a/Bio/Phylo/NeXMLIO.py b/Bio/Phylo/NeXMLIO.py -index 8b173d6528..e18364824a 100644 ---- a/Bio/Phylo/NeXMLIO.py -+++ b/Bio/Phylo/NeXMLIO.py -@@ -138,7 +138,7 @@ def parse(self, values_are_confidence=False, rooted=False): - node_children = {} - root = None - -- child_tags = node.getchildren() -+ child_tags = list(node) - nodes = [] - edges = [] - for child in child_tags: -@@ -155,7 +155,7 @@ def parse(self, values_are_confidence=False, rooted=False): - if "root" in node.attrib and node.attrib["root"] == "true": - root = node_id - -- for child in node.getchildren(): -+ for child in node: - if child.tag == qUri("nex:meta"): - self.add_annotation(node_dict[node_id], child) - -@@ -176,7 +176,7 @@ def parse(self, values_are_confidence=False, rooted=False): - ): - node_dict[tar]["confidence"] = float(edge.attrib["content"]) - -- for child in edge.getchildren(): -+ for child in edge: - if child.tag == qUri("nex:meta"): - self.add_annotation(node_dict[tar], child) - -From ba893ee4afdcb6bf8e763f3e09ffab1698276ebd Mon Sep 17 00:00:00 2001 -From: Chris Rands -Date: Sun, 19 Jan 2020 21:23:17 +0100 -Subject: [PATCH] drop redudant arg - ---- - Bio/AlignIO/__init__.py | 4 ++-- - Bio/PDB/PDBParser.py | 2 +- - Bio/SCOP/Cla.py | 4 ++-- - Bio/SearchIO/__init__.py | 2 +- - Bio/SeqIO/AceIO.py | 6 +++--- - Bio/SeqIO/FastaIO.py | 4 ++-- - Bio/SeqIO/IgIO.py | 2 +- - Bio/SeqIO/PdbIO.py | 8 ++++---- - Bio/SeqIO/PhdIO.py | 2 +- - Bio/SeqIO/PirIO.py | 2 +- - Bio/SeqIO/QualityIO.py | 30 +++++++++++++++--------------- - Bio/SeqIO/SwissIO.py | 2 +- - Bio/SeqIO/TabIO.py | 2 +- - Bio/SeqIO/UniprotIO.py | 2 +- - Bio/phenotype/__init__.py | 2 +- - Tests/test_KGML_graphics.py | 2 +- - Tests/test_KGML_graphics_online.py | 2 +- - Tests/test_KGML_nographics.py | 4 ++-- - Tests/test_PDB.py | 2 +- - 19 files changed, 42 insertions(+), 42 deletions(-) - -diff --git a/Bio/AlignIO/__init__.py b/Bio/AlignIO/__init__.py -index fc92dc161c..963a424f91 100644 ---- a/Bio/AlignIO/__init__.py -+++ b/Bio/AlignIO/__init__.py -@@ -364,7 +364,7 @@ def parse(handle, format, seq_count=None, alphabet=None): - if seq_count is not None and not isinstance(seq_count, int): - raise TypeError("Need integer for seq_count (sequences per alignment)") - -- with as_handle(handle, "rU") as fp: -+ with as_handle(handle) as fp: - # Map the file format to a sequence iterator: - if format in _FormatToIterator: - iterator_generator = _FormatToIterator[format] -@@ -471,7 +471,7 @@ def convert(in_file, in_format, out_file, out_format, alphabet=None): - """ - # TODO - Add optimised versions of important conversions - # For now just off load the work to SeqIO parse/write -- with as_handle(in_file, "rU") as in_handle: -+ with as_handle(in_file) as in_handle: - # Don't open the output file until we've checked the input is OK: - alignments = parse(in_handle, in_format, None, alphabet) - -diff --git a/Bio/PDB/PDBParser.py b/Bio/PDB/PDBParser.py -index bc78486b0e..c85b4bb612 100644 ---- a/Bio/PDB/PDBParser.py -+++ b/Bio/PDB/PDBParser.py -@@ -89,7 +89,7 @@ def get_structure(self, id, file): - # Make a StructureBuilder instance (pass id of structure as parameter) - self.structure_builder.init_structure(id) - -- with as_handle(file, mode="rU") as handle: -+ with as_handle(file) as handle: - lines = handle.readlines() - if not lines: - raise ValueError("Empty file.") -diff --git a/Bio/SCOP/Cla.py b/Bio/SCOP/Cla.py -index 50ee85e029..3546eaa587 100644 ---- a/Bio/SCOP/Cla.py -+++ b/Bio/SCOP/Cla.py -@@ -103,7 +103,7 @@ def __init__(self, filename): - """ - dict.__init__(self) - self.filename = filename -- with open(self.filename, "rU") as f: -+ with open(self.filename) as f: - position = 0 - while True: - line = f.readline() -@@ -121,7 +121,7 @@ def __getitem__(self, key): - """Return an item from the indexed file.""" - position = dict.__getitem__(self, key) - -- with open(self.filename, "rU") as f: -+ with open(self.filename) as f: - f.seek(position) - line = f.readline() - record = Record(line) -diff --git a/Bio/SearchIO/__init__.py b/Bio/SearchIO/__init__.py -index 04ef42fa81..1f7b5768e9 100755 ---- a/Bio/SearchIO/__init__.py -+++ b/Bio/SearchIO/__init__.py -@@ -314,7 +314,7 @@ - handle_kwargs["encoding"] = "utf-8" - - # and start iterating -- with as_handle(handle, "rU", **handle_kwargs) as source_file: -+ with as_handle(handle, **handle_kwargs) as source_file: - generator = iterator(source_file, **kwargs) - - for qresult in generator: -diff --git a/Bio/SeqIO/AceIO.py b/Bio/SeqIO/AceIO.py -index 516759a520..b8923543ef 100644 ---- a/Bio/SeqIO/AceIO.py -+++ b/Bio/SeqIO/AceIO.py -@@ -32,7 +32,7 @@ def AceIterator(handle): - letter_annotations dictionary under the "phred_quality" key. - - >>> from Bio import SeqIO -- >>> with open("Ace/consed_sample.ace", "rU") as handle: -+ >>> with open("Ace/consed_sample.ace") as handle: - ... for record in SeqIO.parse(handle, "ace"): - ... print("%s %s... %i" % (record.id, record.seq[:10], len(record))) - ... print(max(record.letter_annotations["phred_quality"])) -@@ -47,7 +47,7 @@ def AceIterator(handle): - prevented output of the gapped sequence as FASTQ format. - - >>> from Bio import SeqIO -- >>> with open("Ace/contig1.ace", "rU") as handle: -+ >>> with open("Ace/contig1.ace") as handle: - ... for record in SeqIO.parse(handle, "ace"): - ... print("%s ...%s..." % (record.id, record.seq[85:95])) - ... print(record.letter_annotations["phred_quality"][85:95]) -@@ -60,7 +60,7 @@ def AceIterator(handle): - 90 - - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - - for ace_contig in Ace.parse(handle): - # Convert the ACE contig record into a SeqRecord... -diff --git a/Bio/SeqIO/FastaIO.py b/Bio/SeqIO/FastaIO.py -index f5fbe94b61..7baf92c2ed 100644 ---- a/Bio/SeqIO/FastaIO.py -+++ b/Bio/SeqIO/FastaIO.py -@@ -174,7 +174,7 @@ def FastaIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - DELTA - - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - if title2ids: - for title, sequence in SimpleFastaParser(handle): - id, name, descr = title2ids(title) -@@ -210,7 +210,7 @@ def FastaTwoLineIterator(handle, alphabet=single_letter_alphabet): - Only the default title to ID/name/description parsing offered - by the relaxed FASTA parser is offered. - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - for title, sequence in FastaTwoLineParser(handle): - try: - first_word = title.split(None, 1)[0] -diff --git a/Bio/SeqIO/IgIO.py b/Bio/SeqIO/IgIO.py -index 10d71a84af..f5157c7b7b 100644 ---- a/Bio/SeqIO/IgIO.py -+++ b/Bio/SeqIO/IgIO.py -@@ -59,7 +59,7 @@ def IgIterator(handle, alphabet=single_letter_alphabet): - SYK_SYK length 330 - - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - - # Skip any file header text before the first record (;; lines) - while True: -diff --git a/Bio/SeqIO/PdbIO.py b/Bio/SeqIO/PdbIO.py -index 165673d309..6214e63d97 100644 ---- a/Bio/SeqIO/PdbIO.py -+++ b/Bio/SeqIO/PdbIO.py -@@ -148,7 +148,7 @@ def PdbSeqresIterator(handle): - - chains = collections.defaultdict(list) - metadata = collections.defaultdict(list) -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - for line in handle: - empty = False - rec_name = line[0:6].strip() -@@ -283,7 +283,7 @@ def PdbAtomIterator(handle): - # Only import PDB when needed, to avoid/delay NumPy dependency in SeqIO - from Bio.PDB import PDBParser - -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - struct = PDBParser().get_structure(None, handle) - pdb_id = struct.header["idcode"] - if not pdb_id: -@@ -368,7 +368,7 @@ def CifSeqresIterator(handle): - # Only import PDB when needed, to avoid/delay NumPy dependency in SeqIO - from Bio.PDB.MMCIF2Dict import MMCIF2Dict - -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - - chains = collections.defaultdict(list) - metadata = collections.defaultdict(list) -@@ -498,7 +498,7 @@ def CifAtomIterator(handle): - # file. We copy the contents of the handle into a StringIO buffer first, - # so that both MMCIF2Dict and MMCIFParser can consume the handle. - buffer = StringIO() -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - shutil.copyfileobj(handle, buffer) - - # check if file is empty -diff --git a/Bio/SeqIO/PhdIO.py b/Bio/SeqIO/PhdIO.py -index 27ba7a8395..3c2dedfa52 100644 ---- a/Bio/SeqIO/PhdIO.py -+++ b/Bio/SeqIO/PhdIO.py -@@ -65,7 +65,7 @@ def PhdIterator(handle): - - This uses the Bio.Sequencing.Phd module to do the hard work. - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - phd_records = Phd.parse(handle) - for phd_record in phd_records: - # Convert the PHY record into a SeqRecord... -diff --git a/Bio/SeqIO/PirIO.py b/Bio/SeqIO/PirIO.py -index d4ed6c0703..aa462032b1 100644 ---- a/Bio/SeqIO/PirIO.py -+++ b/Bio/SeqIO/PirIO.py -@@ -141,7 +141,7 @@ def PirIterator(handle): - HLA:HLA01083 length 188 - - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - # Skip any text before the first record (e.g. blank lines, comments) - while True: - line = handle.readline() -diff --git a/Bio/SeqIO/QualityIO.py b/Bio/SeqIO/QualityIO.py -index 9516313070..73152d5b10 100644 ---- a/Bio/SeqIO/QualityIO.py -+++ b/Bio/SeqIO/QualityIO.py -@@ -888,7 +888,7 @@ def FastqGeneralIterator(handle): - Using this tricky example file as input, this short bit of code demonstrates - what this parsing function would return: - -- >>> with open("Quality/tricky.fastq", "rU") as handle: -+ >>> with open("Quality/tricky.fastq") as handle: - ... for (title, sequence, quality) in FastqGeneralIterator(handle): - ... print(title) - ... print("%s %s" % (sequence, quality)) -@@ -909,7 +909,7 @@ def FastqGeneralIterator(handle): - is that (provided there are no line breaks in the quality sequence) it - would prevent the above problem with the "@" character. - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - # We need to call handle.readline() at least four times per record, - # so we'll save a property look up each time: - handle_readline = handle.readline -@@ -1016,7 +1016,7 @@ def FastqPhredIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - - Using this module directly you might run: - -- >>> with open("Quality/example.fastq", "rU") as handle: -+ >>> with open("Quality/example.fastq") as handle: - ... for record in FastqPhredIterator(handle): - ... print("%s %s" % (record.id, record.seq)) - EAS54_6_R1_2_1_413_324 CCCTTCTTGTCTTCAGCGTTTCTCC -@@ -1027,7 +1027,7 @@ def FastqPhredIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - (or "fastq-sanger") as the format: - - >>> from Bio import SeqIO -- >>> with open("Quality/example.fastq", "rU") as handle: -+ >>> with open("Quality/example.fastq") as handle: - ... for record in SeqIO.parse(handle, "fastq"): - ... print("%s %s" % (record.id, record.seq)) - EAS54_6_R1_2_1_413_324 CCCTTCTTGTCTTCAGCGTTTCTCC -@@ -1111,7 +1111,7 @@ def FastqSolexaIterator(handle, alphabet=single_letter_alphabet, title2ids=None) - - Using this module directly you might run: - -- >>> with open("Quality/solexa_example.fastq", "rU") as handle: -+ >>> with open("Quality/solexa_example.fastq") as handle: - ... for record in FastqSolexaIterator(handle): - ... print("%s %s" % (record.id, record.seq)) - SLXA-B3_649_FC8437_R1_1_1_610_79 GATGTGCAATACCTTTGTAGAGGAA -@@ -1124,7 +1124,7 @@ def FastqSolexaIterator(handle, alphabet=single_letter_alphabet, title2ids=None) - "fastq-solexa" as the format: - - >>> from Bio import SeqIO -- >>> with open("Quality/solexa_example.fastq", "rU") as handle: -+ >>> with open("Quality/solexa_example.fastq") as handle: - ... for record in SeqIO.parse(handle, "fastq-solexa"): - ... print("%s %s" % (record.id, record.seq)) - SLXA-B3_649_FC8437_R1_1_1_610_79 GATGTGCAATACCTTTGTAGAGGAA -@@ -1160,7 +1160,7 @@ def FastqSolexaIterator(handle, alphabet=single_letter_alphabet, title2ids=None) - use the Bio.SeqIO.read() function: - - >>> from Bio import SeqIO -- >>> with open("Quality/solexa_faked.fastq", "rU") as handle: -+ >>> with open("Quality/solexa_faked.fastq") as handle: - ... record = SeqIO.read(handle, "fastq-solexa") - >>> print("%s %s" % (record.id, record.seq)) - slxa_0001_1_0001_01 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTNNNNNN -@@ -1300,7 +1300,7 @@ def QualPhredIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - - Using this module directly you might run: - -- >>> with open("Quality/example.qual", "rU") as handle: -+ >>> with open("Quality/example.qual") as handle: - ... for record in QualPhredIterator(handle): - ... print("%s %s" % (record.id, record.seq)) - EAS54_6_R1_2_1_413_324 ????????????????????????? -@@ -1311,7 +1311,7 @@ def QualPhredIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - as the format: - - >>> from Bio import SeqIO -- >>> with open("Quality/example.qual", "rU") as handle: -+ >>> with open("Quality/example.qual") as handle: - ... for record in SeqIO.parse(handle, "qual"): - ... print("%s %s" % (record.id, record.seq)) - EAS54_6_R1_2_1_413_324 ????????????????????????? -@@ -1327,7 +1327,7 @@ def QualPhredIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - - >>> from Bio import SeqIO - >>> from Bio.Alphabet import generic_dna -- >>> with open("Quality/example.qual", "rU") as handle: -+ >>> with open("Quality/example.qual") as handle: - ... for record in SeqIO.parse(handle, "qual", alphabet=generic_dna): - ... print("%s %s" % (record.id, record.seq)) - EAS54_6_R1_2_1_413_324 NNNNNNNNNNNNNNNNNNNNNNNNN -@@ -1350,7 +1350,7 @@ def QualPhredIterator(handle, alphabet=single_letter_alphabet, title2ids=None): - scores but will replace them with the lowest possible PHRED score of zero. - This will trigger a warning, previously it raised a ValueError exception. - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - # Skip any text before the first record (e.g. blank lines, comments) - while True: - line = handle.readline() -@@ -1882,8 +1882,8 @@ def PairedFastaQualIterator( - can't be used to read the two files together - but this function can! - For example, - -- >>> with open("Quality/example.fasta", "rU") as f: -- ... with open("Quality/example.qual", "rU") as q: -+ >>> with open("Quality/example.fasta") as f: -+ ... with open("Quality/example.qual") as q: - ... for record in PairedFastaQualIterator(f, q): - ... print("%s %s" % (record.id, record.seq)) - ... -@@ -1903,8 +1903,8 @@ def PairedFastaQualIterator( - this function to convert paired FASTA and QUAL files into FASTQ files: - - >>> from Bio import SeqIO -- >>> with open("Quality/example.fasta", "rU") as f: -- ... with open("Quality/example.qual", "rU") as q: -+ >>> with open("Quality/example.fasta") as f: -+ ... with open("Quality/example.qual") as q: - ... SeqIO.write(PairedFastaQualIterator(f, q), "Quality/temp.fastq", "fastq") - ... - 3 -diff --git a/Bio/SeqIO/SwissIO.py b/Bio/SeqIO/SwissIO.py -index c2e5be16b8..b9730dcff0 100644 ---- a/Bio/SeqIO/SwissIO.py -+++ b/Bio/SeqIO/SwissIO.py -@@ -73,7 +73,7 @@ def SwissIterator(handle): - Rather than calling it directly, you are expected to use this - parser via Bio.SeqIO.parse(..., format="swiss") instead. - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - swiss_records = SwissProt.parse(handle) - - for swiss_record in swiss_records: -diff --git a/Bio/SeqIO/TabIO.py b/Bio/SeqIO/TabIO.py -index 3f99fe40ac..686046c134 100644 ---- a/Bio/SeqIO/TabIO.py -+++ b/Bio/SeqIO/TabIO.py -@@ -73,7 +73,7 @@ def TabIterator(handle, alphabet=single_letter_alphabet): - gi|45478721|ref|NP_995576.1| length 90 - - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - for line in handle: - try: - title, seq = line.split("\t") # will fail if more than one tab! -diff --git a/Bio/SeqIO/UniprotIO.py b/Bio/SeqIO/UniprotIO.py -index c8307beaa9..ff75ab8268 100644 ---- a/Bio/SeqIO/UniprotIO.py -+++ b/Bio/SeqIO/UniprotIO.py -@@ -43,7 +43,7 @@ def UniprotIterator( - return_raw_comments = True --> comment fields are returned as complete XML to allow further processing - skip_parsing_errors = True --> if parsing errors are found, skip to next entry - """ -- with as_handle(handle, "rU") as handle: -+ with as_handle(handle) as handle: - - # check if file is empty - if handle.readline() == "": -diff --git a/Bio/phenotype/__init__.py b/Bio/phenotype/__init__.py -index 03b1d3926b..df70bb745d 100644 ---- a/Bio/phenotype/__init__.py -+++ b/Bio/phenotype/__init__.py -@@ -178,7 +178,7 @@ def parse(handle, format): - if format != format.lower(): - raise ValueError("Format string '%s' should be lower case" % format) - -- with as_handle(handle, "rU") as fp: -+ with as_handle(handle) as fp: - # Map the file format to a sequence iterator: - if format in _FormatToIterator: - iterator_generator = _FormatToIterator[format] -diff --git a/Tests/test_KGML_graphics.py b/Tests/test_KGML_graphics.py -index cb05c29249..f66e089ff8 100644 ---- a/Tests/test_KGML_graphics.py -+++ b/Tests/test_KGML_graphics.py -@@ -108,7 +108,7 @@ def test_render_KGML_basic(self): - # We test rendering of the original KEGG KGML using only local - # files. - for p in self.data: -- with open(p.infilename, "rU") as f: -+ with open(p.infilename) as f: - pathway = read(f) - pathway.image = p.pathway_image - kgml_map = KGMLCanvas(pathway) -diff --git a/Tests/test_KGML_graphics_online.py b/Tests/test_KGML_graphics_online.py -index 22d923daf0..3c101df913 100644 ---- a/Tests/test_KGML_graphics_online.py -+++ b/Tests/test_KGML_graphics_online.py -@@ -74,7 +74,7 @@ def test_render_KGML_import_map(self): - """ - # We test rendering of the original KEGG KGML using imported files - for p in self.data: -- with open(p.infilename, "rU") as f: -+ with open(p.infilename) as f: - pathway = read(f) - kgml_map = KGMLCanvas(pathway, import_imagemap=True) - kgml_map.draw(p.output_stem + "_importmap.pdf") -diff --git a/Tests/test_KGML_nographics.py b/Tests/test_KGML_nographics.py -index 105a7be415..8102af4ade 100644 ---- a/Tests/test_KGML_nographics.py -+++ b/Tests/test_KGML_nographics.py -@@ -83,7 +83,7 @@ def test_read_and_write_KGML_files(self): - """ - for p in self.data: - # Test opening file -- with open(p.infilename, "rU") as f: -+ with open(p.infilename) as f: - pathway = read(f) - # Do we have the correct number of elements of each type - self.assertEqual((len(pathway.entries), -@@ -95,7 +95,7 @@ def test_read_and_write_KGML_files(self): - with open(p.outfilename, "w") as f: - f.write(pathway.get_KGML()) - # Can we read the file we wrote? -- with open(p.outfilename, "rU") as f: -+ with open(p.outfilename) as f: - pathway = read(f) - # Do we have the correct number of elements of each type - self.assertEqual((len(pathway.entries), ---- a/Tests/test_PDB.py.python39 2019-12-20 13:37:02.000000000 +0100 -+++ b/Tests/test_PDB.py 2020-03-01 14:58:17.590202068 +0100 -@@ -538,7 +538,7 @@ - try: - io.save(filename) - # Check if there are lines besides 'ATOM', 'TER' and 'END' -- with open(filename, "rU") as handle: -+ with open(filename) as handle: - record_set = {l[0:6] for l in handle} - record_set -= {"ATOM ", "HETATM", "MODEL ", "ENDMDL", "TER\n", "TER ", "END\n", "END "} - self.assertEqual(record_set, set()) diff --git a/python-biopython.spec b/python-biopython.spec index e183d92..97509a4 100644 --- a/python-biopython.spec +++ b/python-biopython.spec @@ -28,8 +28,6 @@ Release: 2%{?dist} Summary: Python tools for computational molecular biology Source0: %{pypi_source} -Patch0: %{name}-1.76_python39.patch - # Starting from biopython-1.69, BioPython is released under the # "Biopython License Agreement"; it looks like a MIT variant # rhbz #1440337 @@ -176,11 +174,6 @@ cp -a %{module}-%{version} python2 %if 0%{?with_python3} cp -a %{module}-%{version} python3 -%if 0%{?python3_version_nodots} == 39 -pushd python3 -%patch0 -p1 -b .python39 -popd -%endif %endif # with_python3 @@ -320,8 +313,9 @@ popd %license %{module}-%{version}/LICENSE.rst %changelog -* Tue May 26 2020 Miro HronĨok - 1.77-2 +* Fri May 29 2020 Antonio Trande - 1.77-2 - Rebuilt for Python 3.9 +- Remove obsolete Python3.9 patch * Mon May 25 2020 Antonio Trande - 1.77-1 - Release 1.77